ID: 1146542537_1146542541

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1146542537 1146542541
Species Human (GRCh38) Human (GRCh38)
Location 17:33710048-33710070 17:33710078-33710100
Sequence CCAAGCTCCATAGGTTGATGGAG GAGATGAGATTTCTCCTCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91} {0: 1, 1: 0, 2: 22, 3: 435, 4: 4933}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!