ID: 1146549781_1146549791

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1146549781 1146549791
Species Human (GRCh38) Human (GRCh38)
Location 17:33770303-33770325 17:33770353-33770375
Sequence CCTCCCTGACCCCTAGTGTCTTC CAGTTGGTGTAAACATTTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 434} {0: 1, 1: 0, 2: 2, 3: 38, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!