ID: 1146552349_1146552360

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1146552349 1146552360
Species Human (GRCh38) Human (GRCh38)
Location 17:33792255-33792277 17:33792307-33792329
Sequence CCATTCTCCACTGTTCAGTGCCA CTCTGGACAATGACCAGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 255} {0: 1, 1: 0, 2: 1, 3: 10, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!