ID: 1146558582_1146558588

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1146558582 1146558588
Species Human (GRCh38) Human (GRCh38)
Location 17:33848668-33848690 17:33848682-33848704
Sequence CCTGCTCCCCAAGGCATTCTAGG CATTCTAGGCAGTAGCTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157} {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!