ID: 1146565364_1146565369

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1146565364 1146565369
Species Human (GRCh38) Human (GRCh38)
Location 17:33908361-33908383 17:33908393-33908415
Sequence CCATATTGGACTATCTATTTTCT ATAGAGAAGCAGACAGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 273} {0: 1, 1: 0, 2: 3, 3: 60, 4: 630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!