ID: 1146574365_1146574368

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1146574365 1146574368
Species Human (GRCh38) Human (GRCh38)
Location 17:33978632-33978654 17:33978646-33978668
Sequence CCACCTGTGTCAAATTCCTATGC TTCCTATGCTTACGGTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 141} {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!