ID: 1146578044_1146578057

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1146578044 1146578057
Species Human (GRCh38) Human (GRCh38)
Location 17:34012046-34012068 17:34012087-34012109
Sequence CCTTCCTCCCTCCCCTTATTTTG CCTGCCTGACACCAAGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 43, 3: 146, 4: 1165} {0: 1, 1: 0, 2: 0, 3: 25, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!