ID: 1146583307_1146583321

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1146583307 1146583321
Species Human (GRCh38) Human (GRCh38)
Location 17:34059344-34059366 17:34059396-34059418
Sequence CCCTGGGTCTCTAAGCAGCCCAT GAGGGTGGCGAGAGGAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 172} {0: 1, 1: 48, 2: 76, 3: 152, 4: 805}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!