ID: 1146588052_1146588058

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1146588052 1146588058
Species Human (GRCh38) Human (GRCh38)
Location 17:34100062-34100084 17:34100087-34100109
Sequence CCCCAGGAACCGCAAACACATTG CCTGCAGACCACCAAAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108} {0: 1, 1: 0, 2: 2, 3: 18, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!