ID: 1146597678_1146597691

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1146597678 1146597691
Species Human (GRCh38) Human (GRCh38)
Location 17:34184204-34184226 17:34184254-34184276
Sequence CCTGGGGCAGGGGCAAGTACCCC GCAAGTCCTGCTTTTCTAGGGGG
Strand - +
Off-target summary {0: 146, 1: 46, 2: 15, 3: 24, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!