ID: 1146631156_1146631160

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1146631156 1146631160
Species Human (GRCh38) Human (GRCh38)
Location 17:34470413-34470435 17:34470435-34470457
Sequence CCAATAAAACTTTCTTCCTATAA AGCAGGCATCTGGTCAGATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 32, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!