ID: 1146633235_1146633239

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1146633235 1146633239
Species Human (GRCh38) Human (GRCh38)
Location 17:34485353-34485375 17:34485371-34485393
Sequence CCTGTCAGCCTGCTGGGGCTTTG CTTTGCAGACGCAGACGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!