ID: 1146636971_1146636977

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1146636971 1146636977
Species Human (GRCh38) Human (GRCh38)
Location 17:34513720-34513742 17:34513758-34513780
Sequence CCAGGAGGTGAGGGCTACTGTTC TGGGGACAGTCCCCCTGTTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!