ID: 1146685293_1146685303

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1146685293 1146685303
Species Human (GRCh38) Human (GRCh38)
Location 17:34837377-34837399 17:34837415-34837437
Sequence CCACCCTGAAGATGTTCTACCAG TGAGGGAAATGAGGAAAAGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 117, 4: 959}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!