ID: 1146696053_1146696064

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1146696053 1146696064
Species Human (GRCh38) Human (GRCh38)
Location 17:34909739-34909761 17:34909786-34909808
Sequence CCCACACCCAGTGGGGGCAGAGT TCTGGCTCCCCCCATGCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 187} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!