ID: 1146711295_1146711300

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1146711295 1146711300
Species Human (GRCh38) Human (GRCh38)
Location 17:35043970-35043992 17:35043990-35044012
Sequence CCCCCAACCTTCTAAAGATAAAG AAGCCTTTAACTGATATTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 200} {0: 1, 1: 0, 2: 1, 3: 12, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!