ID: 1146720096_1146720103

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1146720096 1146720103
Species Human (GRCh38) Human (GRCh38)
Location 17:35118157-35118179 17:35118199-35118221
Sequence CCATGTCAGGAGACATTTTTGAT CTGGTGCTACTGGCATCTAGTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 41, 3: 88, 4: 285} {0: 1, 1: 22, 2: 202, 3: 610, 4: 1209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!