ID: 1146738226_1146738229

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1146738226 1146738229
Species Human (GRCh38) Human (GRCh38)
Location 17:35258110-35258132 17:35258158-35258180
Sequence CCAGCAGACTCAGCTCCTCAACT AAATCTGACCTCAAGCTATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 305} {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!