ID: 1146743298_1146743305

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1146743298 1146743305
Species Human (GRCh38) Human (GRCh38)
Location 17:35305379-35305401 17:35305399-35305421
Sequence CCATCACCCTCACAGAGCCCTGG TGGGTAAGTTTGACCATTGAAGG
Strand - +
Off-target summary {0: 19, 1: 43, 2: 62, 3: 75, 4: 613} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!