ID: 1146763862_1146763866

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1146763862 1146763866
Species Human (GRCh38) Human (GRCh38)
Location 17:35501266-35501288 17:35501287-35501309
Sequence CCAATGGAGGATCAATATGGTGG GGCTGAACACCAGGAGGAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 126} {0: 1, 1: 0, 2: 2, 3: 29, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!