ID: 1146775367_1146775375

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1146775367 1146775375
Species Human (GRCh38) Human (GRCh38)
Location 17:35609716-35609738 17:35609764-35609786
Sequence CCTCCCACCTTGGCCTTCCTCAG TTTTCTTAGTGAACTTTAAATGG
Strand - +
Off-target summary {0: 1, 1: 15, 2: 1322, 3: 26848, 4: 82704} {0: 1, 1: 0, 2: 6, 3: 53, 4: 805}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!