ID: 1146782134_1146782142

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1146782134 1146782142
Species Human (GRCh38) Human (GRCh38)
Location 17:35683783-35683805 17:35683824-35683846
Sequence CCTTGGGCCACCCAGAAATGGGG CATAAAGCAGAGACCCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 211} {0: 1, 1: 0, 2: 2, 3: 20, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!