ID: 1146790570_1146790580

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1146790570 1146790580
Species Human (GRCh38) Human (GRCh38)
Location 17:35748386-35748408 17:35748420-35748442
Sequence CCACAGGTTCTTGCCCCTATCTG TACTGCCTCAGGTCTAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 183} {0: 1, 1: 0, 2: 0, 3: 16, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!