ID: 1146797471_1146797482

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1146797471 1146797482
Species Human (GRCh38) Human (GRCh38)
Location 17:35793256-35793278 17:35793309-35793331
Sequence CCAAGATGAAATTCTCTCCATCT ATGCCTCTGTTCCCTTGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 385} {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!