ID: 1146822393_1146822395

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1146822393 1146822395
Species Human (GRCh38) Human (GRCh38)
Location 17:35994104-35994126 17:35994135-35994157
Sequence CCAGGATAAAGCTACAAGCACAG ATAAAAAAGGATATTTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 125} {0: 1, 1: 0, 2: 4, 3: 48, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!