ID: 1146823376_1146823380

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1146823376 1146823380
Species Human (GRCh38) Human (GRCh38)
Location 17:36002299-36002321 17:36002330-36002352
Sequence CCTCTTAGTGCACATACTTGAGC CTGACTCCTGAGATCTTAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 21, 3: 139, 4: 490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!