ID: 1146842591_1146842605

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1146842591 1146842605
Species Human (GRCh38) Human (GRCh38)
Location 17:36166241-36166263 17:36166286-36166308
Sequence CCAAGGCCCCTCTACGTCCAGGT GTTCCACTGCAGGAATCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 2, 3: 15, 4: 113} {0: 15, 1: 0, 2: 3, 3: 12, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!