ID: 1146843703_1146843707

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1146843703 1146843707
Species Human (GRCh38) Human (GRCh38)
Location 17:36170943-36170965 17:36170959-36170981
Sequence CCTCCTGGGGCGACTCCTTCATC CTTCATCCTCCAAGTCTCCAGGG
Strand - +
Off-target summary {0: 14, 1: 1, 2: 5, 3: 3, 4: 100} {0: 18, 1: 0, 2: 5, 3: 29, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!