ID: 1146849753_1146849759

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1146849753 1146849759
Species Human (GRCh38) Human (GRCh38)
Location 17:36211952-36211974 17:36211977-36211999
Sequence CCTGTTTTGGGGAGGGGGTGATG CGTTGGGGAGGCAGCTCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 42, 4: 445} {0: 1, 1: 0, 2: 1, 3: 12, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!