ID: 1146871249_1146871253

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1146871249 1146871253
Species Human (GRCh38) Human (GRCh38)
Location 17:36379808-36379830 17:36379838-36379860
Sequence CCTCTGGGCCAGAACAGAGGATC CAGTGTGAGGAAGCTGCCCTCGG
Strand - +
Off-target summary {0: 14, 1: 5, 2: 2, 3: 15, 4: 255} {0: 20, 1: 0, 2: 2, 3: 47, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!