ID: 1146873045_1146873051

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1146873045 1146873051
Species Human (GRCh38) Human (GRCh38)
Location 17:36387777-36387799 17:36387794-36387816
Sequence CCACAGCTGCCCAAGGGCAGCAG CAGCAGGCTCCCCCGGACAAGGG
Strand - +
Off-target summary {0: 12, 1: 2, 2: 10, 3: 50, 4: 437} {0: 12, 1: 0, 2: 0, 3: 16, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!