ID: 1146873045_1146873058

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1146873045 1146873058
Species Human (GRCh38) Human (GRCh38)
Location 17:36387777-36387799 17:36387814-36387836
Sequence CCACAGCTGCCCAAGGGCAGCAG GGGACCATGTGTGTTCAGTGGGG
Strand - +
Off-target summary {0: 12, 1: 2, 2: 10, 3: 50, 4: 437} {0: 12, 1: 1, 2: 3, 3: 20, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!