ID: 1146877788_1146877797

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1146877788 1146877797
Species Human (GRCh38) Human (GRCh38)
Location 17:36426920-36426942 17:36426963-36426985
Sequence CCACACCTCCCCTCGGCCGGGGC CCCAGTGCCCAGCACAGGCGTGG
Strand - +
Off-target summary {0: 8, 1: 2, 2: 4, 3: 50, 4: 335} {0: 13, 1: 2, 2: 17, 3: 83, 4: 562}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!