ID: 1146877792_1146877799

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1146877792 1146877799
Species Human (GRCh38) Human (GRCh38)
Location 17:36426930-36426952 17:36426968-36426990
Sequence CCTCGGCCGGGGCTCCTGTGTGC TGCCCAGCACAGGCGTGGAACGG
Strand - +
Off-target summary {0: 9, 1: 3, 2: 3, 3: 25, 4: 196} {0: 12, 1: 1, 2: 0, 3: 20, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!