ID: 1146877794_1146877803

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1146877794 1146877803
Species Human (GRCh38) Human (GRCh38)
Location 17:36426944-36426966 17:36426981-36427003
Sequence CCTGTGTGCATCTGTCTCTCCCA CGTGGAACGGAAGAGGTGAATGG
Strand - +
Off-target summary {0: 11, 1: 1, 2: 4, 3: 28, 4: 326} {0: 10, 1: 1, 2: 2, 3: 7, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!