ID: 1146877796_1146877803

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1146877796 1146877803
Species Human (GRCh38) Human (GRCh38)
Location 17:36426963-36426985 17:36426981-36427003
Sequence CCCAGTGCCCAGCACAGGCGTGG CGTGGAACGGAAGAGGTGAATGG
Strand - +
Off-target summary {0: 13, 1: 2, 2: 9, 3: 77, 4: 414} {0: 10, 1: 1, 2: 2, 3: 7, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!