ID: 1146878609_1146878614

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1146878609 1146878614
Species Human (GRCh38) Human (GRCh38)
Location 17:36430890-36430912 17:36430921-36430943
Sequence CCTCTGGGCCAGAACAGAGGATC AGTGTGAGGAAGCTGCCCTCGGG
Strand - +
Off-target summary {0: 14, 1: 5, 2: 2, 3: 15, 4: 255} {0: 15, 1: 7, 2: 3, 3: 24, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!