ID: 1146882086_1146882098

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1146882086 1146882098
Species Human (GRCh38) Human (GRCh38)
Location 17:36450211-36450233 17:36450250-36450272
Sequence CCGATCTCACCCGCTCCGCAGGG AGGGGGCCAGCTGGTCCTCCTGG
Strand - +
Off-target summary {0: 14, 1: 0, 2: 2, 3: 8, 4: 91} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!