ID: 1146882090_1146882102 |
View in Genome Browser |
Spacer: 13 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1146882090 | 1146882102 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 17:36450226-36450248 | 17:36450262-36450284 |
| Sequence | CCGCAGGGTGTTCAGCCTGCCAG | GGTCCTCCTGGGATATGGCACGG |
| Strand | - | + |
| Off-target summary | {0: 13, 1: 0, 2: 24, 3: 154, 4: 737} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||