ID: 1146883197_1146883210

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1146883197 1146883210
Species Human (GRCh38) Human (GRCh38)
Location 17:36454999-36455021 17:36455033-36455055
Sequence CCCGGCCACCGCTCCAGCCCCTC CCTTCATCCTCCAAGTCTCCAGG
Strand - +
Off-target summary {0: 15, 1: 4, 2: 8, 3: 107, 4: 713} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!