ID: 1146889639_1146889641

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1146889639 1146889641
Species Human (GRCh38) Human (GRCh38)
Location 17:36498081-36498103 17:36498102-36498124
Sequence CCCAGTTATAACAAAATAAATAA AATCCAAACCTGCAGCTGATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 100, 4: 1410} {0: 1, 1: 0, 2: 2, 3: 18, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!