ID: 1146906170_1146906181

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1146906170 1146906181
Species Human (GRCh38) Human (GRCh38)
Location 17:36619407-36619429 17:36619456-36619478
Sequence CCTGTAATCCTAGCACTTTGGAA TCAGGGGTTCAAGACCAGCCTGG
Strand - +
Off-target summary No data {0: 1057, 1: 53779, 2: 124571, 3: 172287, 4: 193668}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!