|
Left Crispr |
Right Crispr |
| Crispr ID |
1146985853 |
1146985860 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:37217088-37217110
|
17:37217133-37217155
|
| Sequence |
CCCGTCTTTACTAAAAAATCAAA |
CGCCTGTAATCCCAGCTAATCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 63, 2: 6787, 3: 201883, 4: 247939} |
{0: 107, 1: 21606, 2: 152886, 3: 311819, 4: 402386} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|