ID: 1146985853_1146985860

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1146985853 1146985860
Species Human (GRCh38) Human (GRCh38)
Location 17:37217088-37217110 17:37217133-37217155
Sequence CCCGTCTTTACTAAAAAATCAAA CGCCTGTAATCCCAGCTAATCGG
Strand - +
Off-target summary {0: 1, 1: 63, 2: 6787, 3: 201883, 4: 247939} {0: 107, 1: 21606, 2: 152886, 3: 311819, 4: 402386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!