|
Left Crispr |
Right Crispr |
Crispr ID |
1146985853 |
1146985863 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:37217088-37217110
|
17:37217137-37217159
|
Sequence |
CCCGTCTTTACTAAAAAATCAAA |
TGTAATCCCAGCTAATCGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 63, 2: 6787, 3: 201883, 4: 247939} |
{0: 221, 1: 47799, 2: 215541, 3: 268967, 4: 501988} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|