ID: 1147021942_1147021947

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1147021942 1147021947
Species Human (GRCh38) Human (GRCh38)
Location 17:37541741-37541763 17:37541791-37541813
Sequence CCTGCATGCTGTGCTTGTTTTTA CTGATTTTGACTCCCGTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 540} {0: 1, 1: 0, 2: 0, 3: 4, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!