ID: 1147047093_1147047095 |
View in Genome Browser |
Spacer: -3 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1147047093 | 1147047095 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 17:37760885-37760907 | 17:37760905-37760927 |
| Sequence | CCCAGCTTCAACTGTCTATTAAG | AAGAGATTTTATATATATATAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 1, 2: 10, 3: 94, 4: 944} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||