ID: 1147051387_1147051389

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1147051387 1147051389
Species Human (GRCh38) Human (GRCh38)
Location 17:37797224-37797246 17:37797256-37797278
Sequence CCATTATATGCTCCATTGGGATG ACTTACAAAACACAAATTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 85} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!