ID: 1147068577_1147068585

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1147068577 1147068585
Species Human (GRCh38) Human (GRCh38)
Location 17:37934772-37934794 17:37934788-37934810
Sequence CCCCGCCTCCCAACGGACCTGGA ACCTGGACGTAGAGGGCCCTTGG
Strand - +
Off-target summary {0: 12, 1: 3, 2: 0, 3: 5, 4: 150} {0: 11, 1: 1, 2: 3, 3: 10, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!