ID: 1147080059_1147080073

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1147080059 1147080073
Species Human (GRCh38) Human (GRCh38)
Location 17:38014162-38014184 17:38014207-38014229
Sequence CCACGGGCACCTCGTTCTTCCAC CGGGAAGACACCTACCCTGTGGG
Strand - +
Off-target summary {0: 14, 1: 0, 2: 1, 3: 10, 4: 107} {0: 14, 1: 1, 2: 0, 3: 6, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!