ID: 1147101156_1147101163

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1147101156 1147101163
Species Human (GRCh38) Human (GRCh38)
Location 17:38182220-38182242 17:38182235-38182257
Sequence CCAAGGGCCCTCTACGTCCAGGT GTCCAGGTCCGTTGGGAGGCGGG
Strand - +
Off-target summary {0: 11, 1: 1, 2: 3, 3: 10, 4: 108} {0: 12, 1: 2, 2: 1, 3: 10, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!